The Fast Pink Machine II – Kommentare

Potenzial Produkte: Personen auffinden (Apparat)
allgemeine Vorteile: unbestechlich, unermüdlich, systematisch
spezielle Vorteile: Möglichkeiten des Bevölkerungsamtes erweitern
Marktgrösse: grösser 1 Mio €/Jahr

Viel Menschen fragen wie die The Fast Pink Machine an eine Kläranlage angeschlossen wird. Dies ist ein Thema für eine Veranstaltung mit Spezialisten. In einer Kläranlage. Wer übernimmt die Organisation?

4 Gedanken zu „The Fast Pink Machine II – Kommentare“

  1. Ich vermute folgendes:
    Mikrororganismen fungieren als Rechner.
    Sie suchen ein Muster.
    Beipiel: AACGTTCAAAAACGTTAAACTT.
    Vorgang: eintauchen, packen, vergleichen, markieren.
    Konventionelles Laborgerät bemerkt die markierten Stränge: QQQ/AACGTTCAAAAACGTTAAACTT.
    QQQ finden ist einfach.
    AACGTTCAAAAACGTTAAACTT finden ist aufwändig.

  2. Kläranlage heisst doch viel DNA.
    Dazu kommt mir etwas in den Sinn.

    Oeffentliches Klo, Homo Treffpunkt, Toter.
    Da hat es enorm viel verschiedenes DNA.
    Idee: Mikroorganismen putzen alles zusammen und die FAST PINK MACHINE gibt Auskunft, wer als Täter in Frage kommt.
    Was ist alles? Sperma, Hautschuppen, Haare, Spucke, Urin, ….

  3. Was sind das für wirre Vorstellungen?

    von hinten erklärt:

    die Probe befindet sich im Glasbecher und wird mit einem LASER beleuchtet.
    aufleuchten bedeutet Treffer, nicht aufleuchten bedeutet kein Treffer.
    im Glasbecherbefinden sich Abwasser und DNSZwicker.
    DNA/DNA(mikrobiotisch) der Zielperson bilden die Grundlage für die Herstellung der DNSZwicker.
    Anforderungen an Material: womit können DNSZwicker hergestellt werden?
    Beschreibung der Aufgabe: wer soll gefunden werden?

Schreibe einen Kommentar

Deine E-Mail-Adresse wird nicht veröffentlicht. Erforderliche Felder sind mit * markiert.